学术论文网 The role of desert hedgehog in peripheral t

10 年前 571次浏览 学术论文网 The role of desert hedgehog in peripheral t已关闭评论

The role of desert hedgehog in peripheral t

Published:

Peripheral T cell activation occurs in secondary lymphoyd organs and its complexity is influenced in several steps. Here we demonstrate the role of Desert Hedgehog (Dhh), a morphogen, in the final stages of T cell development. Analysis of Dhh -/- mouse splenocytes revealed that Dhh does indeed play a role in activation of T lymphocytes. The CD4:CD8 ratio increased in KO models compared to WT suggests that Dhh promotes an increment in the proportion of CD4SP T cells, however, studies on activation markers CD69 and CD25 at 18 and 40 hours activation are contradictory. Interestingly, we noticed an unusual T cell activation in unstimulated splenocytes, possibly linked to the pathogenesis of severe form of GvHD.

Desert hedgehog (Dhh) is a mammalian gene. It is the third member of the Hh family. The Hh family is composed of the Sonic hedgehog (Shh), the Indian hedgehog (Ihh) and finally the Desert hedgehog (Dhh). They are all secreted proteins that act as morphogens. From recent studies, it has been revealed that the hedgehog family produce molecules that can work as an activator or inhibitor of the T cell development. (Varas et al. 2003) Although their role hasn't been fully identified yet, it would appear that the Hh signalling plays a role in T-cell lineage commitment and may also affect the signalling events mediated by signalling through the TCRß chain. (Outram et al. 2009) Although it has been demonstrated that both Shh and Ihh interfere with the process of T cell maturation, the role of Desert hedgehog in T cell development has not been studied yet. Thus, the aim of this project was to study the effect of Dhh on T cell activation by comparing activation of CD4 and CD8 T cells isolated from mice that are homozygote knockout for Dhh (Dhh-/-) and wildtype for Dhh (Dhh +/+).

So in order to carry out this project, splenocytes were activated by culturing in the presence of both Anti-CD3 and Anti-CD28. Generally, these molecules are expressed on the surface of activated T cell and bind to the T cell receptor and to B7 molecule, respectively, which are themselves displayed on the surface of antigen-presenting cells.

Three identical experiments were performed in which samples of fresh spleen were taken from three littermate mice and analyzed, cultured and compared to show differences in the percentage representation of peripheral T lymphocytes as well as their ability to be activated following culture with anti-CD3 and anti-CD28.

1.1 Spleen

Fig.1. Spleen in the human body

The spleen is a large secondary lymphoid organ which is important for mounting the immune response to antigens in the periphery. In humans, it is located in the left upper quadrant of the abdomen (Fig.1). The spleen is specialized in filtering blood and trapping blood-bourne antigens, which are carried into the spleen through the splenic artery. The spleen is surrounded by a capsule from which a number of projections extend into the interior to form a compartmentalized structure. In fact, the spleen can be divided in two main zones, the red pulp and the white pulp. The splenic white pulp surrounds the branches of the splenic artery, forming a periarteriolar lymphoid sheath populated mainly by T lymphocytes and it is in this region that the activation of naÏve T cells takes place.

1.2 T cell activation

The early stages of T cell development happen in the thymus. This is because the particular environment of the thymus facilitates the maturation of haematopoietic progenitors into functional T lymphocytes. This process involves bi‑directional signalling between the thymic epithelium and developing thymocytes. During T cell maturation, progenitor thymocytes pass through different stages that can be identified by the expression of the cell surface markers CD4 and CD8: CD4‑CD8‑double negative (DN) cells differentiate into CD4+CD8+ double positive (DP) thymocytes, which mature to become CD4 single positive (SP) and CD8 SP thymocytes. Signalling by a functional pre-T cell receptor (pre-TCR) is necessary for differentiation from DN to DP cell. Maturation from DP to SP cell requires the expres­sion of a functional, MHC‑restricted aßTCR and involves TCR repertoire selection. This phenomenon is known as central tolerance. Positive selection of thymocytes that express TCR with appropriate affinity for self‑MHC molecules ensures functional self‑restriction, while negative selection of thymocytes that express TCR with high affinity for self removes overtly self‑reactive T cell clones; additionally, cell fate is at least in part determined by the strength of the signal coming from the TCR. Once mature, T cells exit the thymus to populate peripheral lymphoid organs such as lymph nodes and spleen where they can be activated on TCR binding to peptide antigen presented by MHC on antigen presenting cells. While CD4 T cells show specificity for peptides presented by self MHC Class II molecules, CD8 T cells recognise antigen as peptide in the context of self MHC Class I molecules. (Kindt et al. 2007 eds)

Once in the secondary lymphoid organs, when naïve T cells encounter the antigen, they are stimu­lated to clonally expand and differentiate into effector cells. This process requires costimulation from antigen presenting cells (APC) and the outcome is influenced by cytokines, the microenvironment and the strength of the TCR signal received.

Peripheral T cell activation and proliferation require a cascade of events. The TCR‑CD3 complex recognises the peptide bound to MHC molecules on the APC-surface, and stimulates T cell activation. In addition, in order to completely activate the T cells, they need costimulatory signals, such as the binding of CD28 on the T cell to CD80/CD86 on the APC (Fig.2). In the absence of costimulatory signals the cell become anergic. These events at the cell surface trigger intracellular signalling events via Immunoreceptor tyrosine‑based activation motifs (ITAMs) on CD3 cytoplasmic domains. These are phosphorylated by Lck causing recruitment and activation of ZAP‑70. This results in the activation of multiple signaling cascades including the MAPKinase, PKC, DAG Kinase, PI3Kinase and Calcineurin pathways, leading to the activation of transcription factors such as NFkB, NFAT and AP‑1. These transcription factors bind to and activate transcription of genes necessary for T cell activation, including IL‑2. (Janeway et al. 2007 eds)

Figure 2. The role of signals 1 and 2 in T-cell activation.

1.3 Desert Hedgehog and Hedgehog signalling pathway

Desert hedgehog (Dhh) is a mammalian gene and it belongs to the Hh family. The Hh family is composed of the Sonic hedgehog (Shh), the Indian hedgehog (Ihh) and finally the Desert hedgehog (Dhh). They are all morphogens.

Morphogens are secreted proteins that are produced at a localised source in tissues and are able to diffuse away from this source forming a concentration gradient. The cell's response to a morphogen depends both on its position within the gradient and on its distance from the source of transmission. Morphogens transmit their signal to neighbouring target cells by binding to their receptor Patched (Ptc), present on their cell-surface. Smoothened (Smo) associates with Ptc on the cell surface and transduces the hedgehog signal in to the cell. In the absence of its Hh ligand, Ptc inhibits the ability of Smo to signal; however, when Hh binds to Ptc, Ptc releases Smo to signal into the cell (Fig.3). The mechanism by which Smo signals into the target cells hasn't been identified yet; all we know is that at the end of the signalling pathway are the Gli family of transcription factors, Gli1, Gli2 and Gli3. They show different functions: Gli1 is an activator of transcription; Gli2 is mostly a positive regulator, whereas Gli3 acts mostly as a negative regulator of transcription. Hh signalling pathway up regulates Gli1 and Gli2 transcription, whereas Gli3 transcription is down regulated by it. The activator function of Gli2 and Gli3 is Hh dependent and requires complex formation with CBP [cAMP response element-binding protein (CREB)-binding protein]. The repressor form of the Gli proteins is formed by cleavage of the full-length molecule and is promoted by phosphorylation by protein kinase A (PKA). (Ingham et al. 2001)

Figure 3. The Hedgehog (Hh) signalling pathway.

1.4 Hypothesis

H0= Desert Hedgehog has no influence in peripheral T cell activation.

HA= Desert Hedgehog does influence peripheral T cell activation.

Materials and methods

Mice

Mice were bred and maintained at the Institute of Child Health/UCL (London, UK). Spleens were isolated from each mouse and brought to the tissue culture laboratory in UEL (London, UK).

Cell suspensions

Cell suspensions of spleen were prepared by gently grinding the organ between frosted glass slides in phosphate-buffered saline (PBS; Sigma). Cell suspensions were diluted 1 in 30 times in a medium buffer and then resuspended.

Estimation of spleen size

An assessment of spleen size was made by counting cells using a microscope counting chamber in order to determine the number of cells per unit volume of a suspension isolated from spleens from homozygote and wildtype Dhh mice.

In vitro T-cell activation

Spleen T lymphocytes were cultured at 5 Ã- 106/mL in AIM-V (Life Technologies), 10−5 M 2ME (Sigma-Aldrich) at 37°C, 5% CO2. Anti-CD3 and anti-CD28 (azide-free [NA/LE; BD PharMingen]) were given at 0.01 μg/mL of each.

Flow cytometry

Splenocytes were stained using anti-CD4, anti-CD8, anti-CD25, anti-CD69 and anti-CD3 fluorescently conjugated antibodies obtained from e-bioscience.

Cell suspensions were stained with the antibodies for 30 min on ice in 50 μl of PBS supplemented with 5% FCS and 0.01% sodium azide. The cells were washed in this medium between incubations and prior to analysis on the FACScan (fluorescence-activated cell scan; located at the Blizard Institute Barts and the London School of Medicine and Dentistry). The events were collected in list mode using CellQuest software (Becton Dickinson), and the data were analyzed using Flowjo (Treestar).

Genotyping

All mice used in these experiments were genotyped for the presence of wildtype and mutant Dhh alleles by doing a polymerase chain reaction on a tail biopsy.

Genotyping were done by two step, DNA extraction and polymerase chain reaction.

DNA extraction

DNA from mice were extracted from 2mm tail tip biopsies by placing in 100l lysis buffer (50mM KCL, 10mM Tris HCL (pH 8.5), 1.5mM MgCL2, 0.01% gelatin, 0.45% Noident P-40, 0.45% Tween20) and 0.5g/ml Proteinase K(Sigma-Aldrich) in ultra pure water (Life Technologies) and incubating on a shaker at 500rpm at 56C overnight or 1200 for 1.5hrs. Then the samples were spun at 13000rpm in a micro-centrifuge for 5 minutes before use.

Polymerase chain reaction (PCR)

DNA (1l) prepared as above were used as a template in each PCR reaction. The primers used for amplifying the specific PCR products were:

Dhh wildtype gene

Forward (Dhh WT f)

ATCCACGTATCGGTCAAAGC

Reverse (Dhh r)

GGTCCAGGAAGAGCAGCAC

Dhh mutated gene

Forward (Dhh KO f)

GGCATGCTGGGGATGCGGTG

Reverse (Dhh r)

GGTCCAGGAAGAGCAGCAC

Each PCR reaction was carried out in 20l mix consisting of DNA, 50% GreenTaq DNA Polymerase (Sigma-Aldrich) and 1M of each relevant primer made up with ultra pure water (Life Technologies). PCR was carried out on a Stratagene Robocycler (Stratagene) as follows: 5 minutes at 94C, 38 cycles for 1:30 minute at 94C, 1 minute at 58C, 1:20 minute at 72C and 10 minutes at 72C.

PCR products were resolved on a 2 % agarose (Sigma-Aldrich) 1x TBE (Life Technologies) gel, stained with 0.001mg/ml ??? (Sigma-Aldrich). A 1kb plus molecular weight marker (Life Technologies) were also electrophoresed to estimate band size of samples. The gel was visualized under ultraviolet light (Herolab, Germany) and a photograph taken (Sony).

Statistical analysis of data

All the experiments were repeated three times in order to collect sufficient data to put through statistical software to determine the level of significance. Statistical analysis was done using paired Student t test.

Results

3.1 Splenocyte populations in wildtype and knockout mice

The analysis of the absolute number of splenocytes was made using a haemocytometer in which 10μl of sample of each mouse had been added. In each experiment the total number of splenocytes isolated from WT mice was set to 1 and the Dhh knockout data was expressed relative to WT. We analyzed the average of the total splenocytes number taken from the mice in the three experiments (Fig.4). Data were collected before activation. Spleens were apparently grossly normal, and although there appeared to be a trend towards a higher splenocyte number in the Dhh KO mice these data did not reach significance.

Fig. 4. Relative cell number in the spleen of WT and KO mice. It was calculated using a haemocytometer. Data represent the average of the three experiments.

3.2 Mean Fluorescence Intensity and CD4:CD8 Ratio

In order to determine the role of Dhh in peripheral T cell activation, we analyzed and compared T lymphocyte populations from WT and Dhh KO mice. Analysis of CD4 and CD8 expression revealed a significant increase in the proportion of CD4SP and CD8SP cells isolated from the spleen in the Dhh KO mice, relative to the WT. Tipically, 17.85% of splenocytes were CD4SP and 9.40% were CD8SP in the KO mice, compared with 12.50% and 7.63%, respectively, in the WT mice (Figure 5B), and the average ratio of CD4SP/CD8SP cells was increased from 1 in the WT to 1.07 in the KO mice (Figure 5A). In order to determine if the increased number of T cells observed in the Dhh KO mice was due to an altered expression of the TCR-CD3 complex on the cell surface, we analyzed cell surface CD3 expression. There was no significant difference in CD3 expression observed on the CD4 and CD8 SP populations isolated from Dhh KO and WT mice spleens (Figure 5C-D). In conclusion, we found a significant increment in the CD4/CD8 T-cell ratio (P=0.01) and in the overall percentage of CD4 and CD8 T cells (Figure 5A-B).

B)

A)

KO

WT

CD4

CD8

C)

D)

Figure 5. Phenotype of Knockout mice. (A) Bar chart to show change in CD4/CD8 ratio in the spleen. (B) CD4 and CD8 profiles in the KO mouse. (C-D) Bar chart and CD3 expression on CD4 (top histograms) and CD8 (bottom histograms) SP splenocytes. Error bars show SE. Data are representative of 3 experiments.

3.3 18 hours activation CD69 and CD25

Given that activation or reduction of Hh signalling altered the outcome of TCR ligation in splenocytes from other mice defective in Hh signalling components (Rowbotham et al. 2007), we investigated the effect of loss of Dhh expression on peripheral T-cell activation. After 18 hours of culture, splenocytes were analysed for the induction of cell surface expression of the early activation marker CD69. Surprisingly, expression was increased in both CD4 and CD8 unstimulated T cells isolated from Dhh KO mice relative to their WT counterparts (Figure 6A-B). In a typical experiment, 7.61% of KO CD4 T cells expressed CD69, compared with 5.61% of WT CD4 T cells (Data not shown). However, expression of the later activation marker CD25 was similar or even decreased in KO cultures (Figure 6C-D) on CD4 and CD8 T cells, from 6.95% and 6.64% in WT CD4 and CD8 T populations, respectively, to 6.71% and 3.98% in their KO counterparts (Data not shown).

To assay T-cell activation, we stimulated splenocytes with anti-CD3 and anti-CD28 antibodies. In stimulated spleen cells (0.01 μg/ml stimulating antibodies), the percentage expression of the activation marker CD69 on CD4 and CD8 T cells was very similar in WT and Dhh KO mice (Figure 6A-B). However, expression of the activation marker CD25 was significantly reduced in KO splenocytes compared to WT (P=0.04) (Figure 6C-D).

In a typical experiment, during the activation process there was a reduction in the presence of CD4 and CD8 population from 23.45% and 32.75% in WT, respectively, to 17.1% and 19% in the Dhh KO mice (Data not shown). Although it did not reach significance, the trend indicates a reduction on splenocytes expressing surface marker CD25 on CD4 and CD8 T cells in Dhh KO mice, which is likely to be due to activation induced cell death.

In cultures of splenocytes stimulated with the lower concentration of antibodies (0.005 μg/ml), in both expression of CD69 and CD25, data confirmed a slight reduction in the percentages of CD69 and CD25 on KO CD4 and CD8 T populations compared to WT (Figure 6A-B-C-D).

B)

A)

D)

C)

Figure 6. Dhh influence on T-cell activation after 18 hours activation. (A) Bar chart to show differences in CD69 on CD4 in WT and KO splenocytes. (B) Bar chart to show differences in CD69 on CD8 in WT and KO splenocytes. (C) Bar chart to show differences in CD25 on CD4 in WT and KO splenocytes. (D) Bar chart to show differences in CD25 on CD8 in WT and KO splenocytes. Error bars show SE. Data are representative of 3 experiments.

3.4 CD69 and CD25 expression following 40 hours activation

Having established that Dhh does influence peripheral T-cell activation following 18 hours culture with the stimulating antibodies, we decided to investigate whether Dhh plays a role later in the activation process. To this end, we performed the staining analysis with the activation markers CD69 and CD25 on splenocytes following 40 hours in culture with the stimulating antibodies. After this period, expression of the early activation marker CD69 was significantly increased in unstimulated CD4 and CD8 T cells (P=0.006) isolated from KO splenocytes compared to WT (Figure 7A-B). The percentages of Dhh KO CD4 and CD8 T cells expressing CD69 were 7.12% and 4.29%, respectively, compared to 4.95% and 3.14% in the WT (Data not shown). Expression of the later activation marker CD25 was also significantly increased (P=0.0006) in KO cultures (Figure 7C-D) on CD4 and CD8 T cells, from 5.44% and 2.33% in WT CD4 and CD8 T populations, respectively, to 8.97% and 4.31% in their KO counterparts (Data not shown). However, after 40 hours stimulation with anti-CD3 and anti-CD28, the differences between CD4 and CD8 T cells expressing CD69 or CD25 were reduced or even absent (Figure 7A-B-C-D). In stimulated (0.01 μg/ml) splenocytes, expression of CD69 passed from 59.09% and 68.7% in WT CD4 and CD8 T cells, respectively, to 59.98% and 68.3% in KO mice. Expression of the later activation marker CD25 passed from 33.75% and 14.0% in CD4 and CD8 T cells in WT mice, respectively, to 31.5% and 14.2% in KO splenocytes. In stimulated splenocytes (0.005 μg/ml), data show a reduction in KO CD4 and CD8 T cells expressing CD69 compared to WT (Fig. 7A-B), while a similar trend in CD4 T cells and slight reduction in CD8 T cells in KO splenocytes, relative to WT control (Figure 7C-D).

B)

A)

C)

D)

Figure 7. Dhh influence on T-cell activation after 18 hours activation. (A) Bar chart to show differences in CD69 on CD4 in WT and KO splenocytes. (B) Bar chart to show differences in CD69 on CD8 in WT and KO splenocytes. (C) Bar chart to show differences in CD25 on CD4 in WT and KO splenocytes. (D) Bar chart to show differences in CD25 on CD8 in WT and KO splenocytes. Error bars show SE. Data are representative of 3 experiments.

3.5 Genotyping

To confirm whether the mice correspond to Wildtype (Dhh +/+) and Knockout (Dhh -/-) for Desert Hedgehog, we performed a polymerase chain reaction (PCR) on a tail biopsy. Then, we performed a gel electrophoresis, DNAs were run on agarose gel and a UV photo of the bands was taken.

KO

WT

Figure 8. UltraViolet photo of DNA's mice. PCR was carried out using primers designed to amplify the wildtype allele (top panel) and the mutated allele (bottom panel). The image show the classification of mice in the three experiments. In the first line (top picture) the 1-2-4-5-7-8 mice were Wildtype; in the second line (bottom picture) the 3-6-9 mice were Knockout.

Discussion

In this study we have shown that the secreted signalling molecule, Desert Hedgehog (Dhh), regulates T cell activation in the peripheral lymphoid organs. It has previously been shown that members of the same family, Sonic Hedgehog (Shh) and Indian Hedgehog (Ihh), both play a role in T cell development delivering both positive and negative signals. (Shah et al. 2004) (Outram et al. 2009)

From previous studies done on the highly conserved sequences of Shh, Ihh, and Dhh the general idea was that they could have overlapping or identical activities. While the three proteins bind the receptor Ptc, large differences in their potency was observed. The rank order of potency was generally Shh>Ihh>Dhh, with Shh and Ihh more closely related in terms of potency than Shh and Dhh, or Ihh and Dhh. Dhh is expressed in Sertoli cells and Leydig cells have been identified as the responding cell type. (Kumar et al. 1996)

Dhh may play distinct roles in the regulation of mitosis and meiosis in the male germline. (Bitgood et al. 1996).

Dhh signalling is a positive regulator of the differentiation of steroid-producing Leydig cells in the fetal testis. (Yao et al. 2002)

The role of Dhh in peripheral T cell activation has previously not been studied. However, the influence of the other two members of the Hedgehog family, Shh and Ihh, has previously been studied and discussed.

From studies done on Shh knockout mice, it has been seen that Shh acts as a positive regulator of the T cell development. It provides signals that regulate the T cell maturation, through the transition from DN1 to DN2, but its action stop at the DN3 stage, after TCRß-chain gene rearrangement It also promotes the production of DP cells. (Shah et al. 2004)

But at the late stages of T cell development, when it comes to the transition from DP to SP CD4 or SP CD8 T cell, the results show that its role is controversial. Shh shows an influence in the TCR repertoire selection and the transition from DP to SP cell in a physiological situation, increasing the differentiation from DP to CD4SP. (Rowbotham et al. 2007)

In contrast, Ihh has negative and positive functions for T cell development and homeostasis in fetal and adult thymus. Ihh produced by thymic stroma promotes T-cell development before pre-TCR signal transduction and Ihh produced by CD4+CD8+DP thymocytes limits T-cell development after pre-TCR signal transduction in a concentration-dependent manner, thereby restricting thymocyte production and thymus size. (Outram et al. 2009)

When it comes to Dhh, analysis of both wildtype and homozygote Dhh models showed that the morphogen is involved in peripheral T cell activation.

In this study we demonstrated that Dhh is indeed involved in peripheral T cell activation, and it is likely to act as a positive regulator. From studies done on CD4:CD8 ratio we found that the increased proportion in KO splenocytes compared to WT, suggests that Dhh plays a role in the differentiation from DP T cells to CD8SP T cells. However, the studies after 18 and 40 hours incubation of splenocytes, show that, there is a significant decrease in activation in the KO CD4SP and CD8SP T cells compared to the WT. Interestingly, there did appear to be some level of spontaneous activation occurring in splenocytes isolated from Dhh KO mice in the absence of stimulating antibodies.

A spontaneous activation of unstimulated T cells has been observed in a GvHD group (Kałwak et al. 2003), thus it is possible that Dhh might have a critical role in the pathogenesis of severe forms of GvHD as well as in the pathogenesis of autoimmune disease which may arise following uncontrolled activation of peripheral T cells.

Although the precise cellular roles of Hh signals are still under scrutiny, it is clear that they can elicit different responses depending on the context in which the signals operate. Thus, Hh signals have been shown to regulate cell fate specification, cell proliferation, and cell survival in different target cells. Signalling can be short- and long-range, direct and indirect, and importantly, concentration- dependent, evoking distinct molecular responses at discrete concentration thresholds. Loss of regulation of Hh signalling has been shown to contribute to various pathologies, most notably various cancers including basal cell carcinoma, the most prevalent cancer in the Caucasian population. (Ingham et al. 2001) Secretion of Hh by a tumour could potentially diminish the immune response to that tumour, allowing escape from immune surveillance. (Taipale et al. 2001)

Therefore, Hedgehog expression has also been detected in infiltrating mononuclear cells and macrophages in human fibrotic lung disease, suggesting that the pathway may play a role in this condition. (Cross et al. 2004)

Indeed, modulation of TCR signal could have a big impact on T cell development. Hh signalling could result in a lowering of the threshold of TCR signalling required for T cell activation. Hh proteins are also expressed in skin, gut and lung. These tissues are subject to recurrent immune challenge, as they are the sites of entry of external pathogens from the environment, from food and air. They are also subject to inflammatory and autoimmune diseases. Hh expression in these tissues during renewal or remodelling after infection or tissue‑damage could function to dampen down the immune response, protecting against the induction of inflammatory or autoimmune diseases. (Taipale et al. 2001)

4.1 Conclusion

In this paper we have supplied an idea of how Desert Hedgehog influences peripheral T cell activation. However, further investigations and more experiments have to be done on this topic. Only a clear understanding of the role of the three members of Hedgehog family can give rise to the development and application of novel therapeutic agents to be used in the treatment of immune disorders.

Acknowledgements

This work was supported by University of East London.

We thank Susan Outram for her support and helpfulness, Kevin Clough (Cell Culture Lab) for procedure of safety and sterility, Gary Warnes (UCL) for flow cytometry.

Referencess o

Bitgood M. et al. (1996) 'Sertoli cell signaling by Desert hedgehog regulates the male germline' Current Biology Vol 6 No 3

Cross S et al. (2004) 'The Hedgehog signalling pathways in human pathology' Current Diagnostic Pathology 10, 157-168

Ingham, P.W. et al. (2001) 'Hedgehog signaling in animal development: paradigms and principles.' Genes Dev. 15, 3059-3087

Janeway, C. et al. (eds) (2007) Janeway's Immunobiology, 7th edn.

Kalwak K. et al. (2003) 'Clinical Value of the Flow Cytometric Method for measuring Lymphocyte Subset Activation: Spontaneous Activation of T-Cell Subpopulations Is Associated With Acute GvHD' Transplantation Proceedings, 35, 1559-1562

Kindt, T.J. et al (eds) (2007) Immunology, 6th edn. Kuby: W. H. Freeman and Company, New York

Kumar S. et al. (1996) 'Evolution of the hedgehog Gene Family' Genetics Society of America

Outram S. et al. (2009) 'Indian hedgehog (Ihh) both promotes and restricts thymocyte differentiation' BLOOD VOL. 113, No.10

Pathi S. et al. (2001) 'Comparative biological responses to human Sonic, Indian and Desert hedgehog' Mechanisms of Development 106; 107 -117

Rowbotham N. J. et al. (2007) 'Activation of the Hedgehog signaling pathway in T-lineage cells inhibits TCR repertoire selection in the thymus and peripheral T-cell activation' BLOOD Vol. 109, No. 9

Shah D. K. et al. (2004) 'Reduced Thymocyte Development in Sonic Hedgehog Knockout Embryos' The Journal of Immunology 172; 2296-2306

Taipale J, Beachy PA. (2001) 'The Hedgehog and Wnt signaling pathways in cancer' Nature; 411:349‑54.

Varas A. et al. (2003) 'The role of morphogens in T-cell development' TRENDS in Immunology Vol.24 No.4

Yao H. et al. (2002) 'Desert Hedgehog/Patched1 signaling specifies fetal Leydig cell fate in testis organogenesis' GENES & DEVELOPMENT 16:1433-1440

阿德莱德代写assignment

这些您可能会感兴趣

筛选出你可能感兴趣的一些文章,让您更加的了解我们。